Social Construction of Race Essay Example | Topics and Well Written Essays - 250 words

Social Construction of Race - Essay Example Or he might consider himself as European because, though he lived in Asia, he lives as a European still. In this case, the basis for race classification is not physical feature but the cultural values of the person. This indicates that we can never know for sure the race of the person by looking at them. 2. Media is one powerful tool in shaping a society’s culture, values and preference. At the present time, the media is used by everyone. And we mean every form media, not just television or radio. Nowadays, the power of social media with the dawn of the World Wide Web is clearly visible. It shapes how people think and believe. Media can actually be used to open the perspective of different nations, not just in critical events such as war, economy and politics but also other issues concerning education, women and crime. Because media can now encompass all ages and all races, it can be used to create a venue for open dialogue between different societies in order to create resolu tions for different problems, whether it’s big or small. It can open a nation’s eyes on how their own people believe in but it also can bridge the gap between different nations.

Bill of Rights and Amendments Paper Essay Example for Free

Bill of Rights and Amendments Paper Essay The United States Constitution was ratified and made law September 17, 1789. For Americas yet-to-be history the Framers knew the Constitution had to have a way to grow and change with the people, and their needs. This paper will cover the amendment process, the need for the Bill of Rights, how the Bill of Rights has affected America, what the Bill of Rights have granted American’s, discuss the later amendments, and what effect the later amendments have had. Amendments In order for America to continue to grow and change with the needs of the people, the Constitution was created with an amendment process in Article V. Article V gives two ways in which the Constitution can be amended; first is by a two-thirds vote from both the House or Representatives and the Senate, it must be ratified by 38 of the50 states. To date this is the only method that has been used. Second method is to hold a Convention called for the sole purpose of amending and two-thirds of the state legislatures must attend. Then it must be ratified by three-fourths of the state legislatures. The Constitution The Framers of the Constitution were specifically concerned with creating a charter for a working government, of the people, for the people, but the Constitution covered very few rights for the American citizen. During the secret convention of 1787,there was some opposition to the Constitution because it was viewed as not  having enough protections for Americas’ rights. â€Å"A bill of rights is what the people are entitled to against every government on earth† Jefferson, T (1787). Including an agreement to add immediately the Bill of Rights, gave way for the Constitution to be ratified. James Madison argued that a declaration of rights for the American people would help the judiciary branch protect individual rights. â€Å"They have given the right of man and fair discussion, and explained them in so clear and forcible manner as cannot fail to make a lasting impression† Washington, G. (1791). The Bill of Rights The Bill of Rights has affected countless court cases on individual rights. Communities and states can become involved to push moral or financial standards on others, and the Bill of Rights stops neighbors, states, and the federal government from infringing on the rights of an individual. The Bill of Rights protects the civil liberties that Americans are granted with citizenship, but it also gives America something to strive to be. The Bill of Rights is an ideal, a powerful statement of what America is trying to be. Amendments beyond the Bill of Rights The Bill of Rights accounts for amendments one through ten. Each of the additional 17 amendments has come about because of clarification needed for the original mechanics of the first three articles or to ensure civil rights. Amendments 11,16, and 24 are for clarifications of Article III. Amendments 12, 17, 20, 22, 25, 26, and 27are for further clarification of Articles I and II. Amendment 23 is further clarification of Article I. Only six amendments are to provide or clarify civil rights, those are13, 14, 15, 18, 19, and 21. Amendment 18 is the only one ever repealed. As we take a deeper look at amendments 13,14, and 15 they were also known as the Reconstruction Amendments. After the Civil War in early 1865 amendment 13 to abolish slavery, was found to be lacking in clarification of what happened to the freed slaves, and the 14th amendment was proposed in 1866, to allow all slaves citizenship. After this the rights for freed Black men came into question, the 15th amendment was created, that race would not bar anyone from the right to vote. Effects of the Constitutional Amendments The amendments beyond the Bill of Rights have each come when needed for the political and changing human rights that America has faced in the past 224 years. Rights have been granted; laws passed and recalled when they were no longer applicable for the climate of what Americans wanted for themselves. Clarifications for the running of the United States government, what should happen in case of emergencies and representation of all citizens have come from a government for the people, by the people. Conclusion Article V of the United States Constitution provides for America to change. The Framers knew that a simple document that was black and white could not govern a people for all time. Our Constitution is alive; it grows with America, and allows changes to be made allowing it stay relevant

The Electoral Process :: President Elections Politics Essays

The Electoral Process There are very many elections each year in America. Though the most important, the national election for president is held every four years. These elections are far from simple in terms of organization. The process for a national election lasts nearly a year. A party must provide nominated people to stand for election. 'Primary election' is the term used in America for the elections which will select the two parties’ presidential nomination. The primary elections start in January of election year and can last until June in what is called the "primary season". Registered voters vote for their delegates. Since 1952 the first primary election has traditionally been in New Hampshire. Of those nominated, only one is selected by the party delegates at the national conventions. This takes place during the summer. The voting body at a national convention is made up of delegates. The delegates, once at a convention, vote for a candidate for the presidential election. The vice-president is also announced at the national convention. Also at the conventions, each party’s policy platform is announced. This is essentially what each party plans to do if elected by the people. After the national conventions, the two parties’ presidential hopefuls can concentrate on campaigning for the ultimate prize in American politics. Each state has a number of delegates attached to it who are members of the state’s Electoral College. It is these people who the voters in that state are in reality voting for as most of these delegates are voted for at the same time as the presidential election. The number of delegates a state gets is dependent on its population and its representation in the House of Representatives. The election of the electors and congress takes place on the first Tuesday in November. The presidential election is done on a winner-take-all basis in a state. Therefore if a candidate has most voters voting for him in a state, he will get all the Electoral votes from that state. This is true even if the number of people who voted against him is greater than the number he received.

Robert Frosts Desert Places and Stopping by Woods on a Snowy Evening :: Robert Frost Poet Poems Desert Woods Essays

Robert Frost's "Desert Places" and "Stopping by Woods on a Snowy Evening" Robert Frost takes our imaginations to a journey through wintertime with his two poems "Desert Places" and "Stopping by Woods on a Snowy Evening". Frost comes from a New England background and these two poems reflect the beautiful scenery that is present in that part of the country. Even though these poems both have winter settings they contain very different tones. One has a feeling of depressing loneliness and the other a feeling of welcome solitude. They show how the same setting can have totally different impacts on a person depending on their mindset at the time. These poems are both made up of simple stanzas and diction but they are not simple poems.   Ã‚  Ã‚  Ã‚  Ã‚  In the poem "Desert Places" the speaker is a man who is traveling through the countryside on a beautiful winter eventing. He is completely surrounded with feelings of loneliness. The speaker views a snow covered field as a deserted place. "A blanker whiteness of benighted snow/ With no expression, nothing to express". Whiteness and blankness are two key ideas in this poem. The white sybolizes open and empty spaces. The snow is a white blanket that covers up everything living. The blankness sybolizes the emptyness that the speaker feels. To him there is nothing else around except for the unfeeling snow and his lonely thoughts.   Ã‚  Ã‚  Ã‚  Ã‚  The speaker in this poem is jealous of the woods. "The woods around it have it - it is theirs." The woods symbolizes people and society. They have something that belongs to them, something to feel a part of. The woods has its place in nature and it is also a part of a bigger picture. The speaker is so alone inside that he feels that he is not a part of anything. Nature has a way of bringing all of her parts together to act as one. Even the animals are a part of this wintery scene. "All animals are smothered in their lairs,/ I am too absent-spirited to count". The snow throws its blanket of whiteness over everything and to him it is a feeling of numbness.   Ã‚  Ã‚  Ã‚  Ã‚  "The loneliness includes me unawares". The speaker has lost his enthusiasm for life. He can not express his feelings easily because of this feeling of numbness. The speaker is also in denial about feeling alone. He is at a stage where he just does not care about too much and he is feeling a bit paranoid. "They cannot scare me with their empty space." He is saying who cares how I feel, I do not need anyone else.

Benefits of a College Graduate

Ana Nunez Nunez (page 1) Ms. Waltman Assignment 6 Credit 5 College Graduate For my assignment on Credit 5 I had to interview a college graduate. I choose to interview my own sister Sandra Galaviz, she is the oldest of four children in my family. She is a college graduate with a four year degree.She has been a great role model to me and she has motivated me to go to college, so I will be able to succeed in my career choice I asked Sandra why she decided to go to college? She told me that she decided to go to college because she wanted to better her future. Have a wide spread opportunities and get a better education for herself. There was one teacher in particular that Sandra wanted to be like. She always looked up to Mrs. Ramirez her seventh grade teacher. Sandra saw teachers as a great role for children.The next thing I asked her was where did you go to college and why did she choose that school? University of Santa Barbara was the college of her choice. She choose this college beca use it was closer to home and she knew she would be homesick. UCSB offers great teaching programs for upcoming teachers. Sandra also knew this school would have great teaching opportunities and help achieve her career goals. Sandra majored in English. She always wanted to become an English teacher as a child. Sandra got her bachelor’s degree and it helped her in many ways.It also, opened up many opportunities and many career options for her future. I asked her what did she like about her college experience? Sandra replied that she got to learn new things, met new people and she got to explore her new interests. Without this experience she wouldn’t be able to be the person she is today. Nunez (page 2) In college you can face several problems. I asked my sister what challenges did she had to overcome in college? She said she faced procrastination and finical problems.Sandra got rid of her bad habit and started working part-time at Walmart to help her finical status. My s ister gave me some advice on looking to go to college. Sandra told me, â€Å"College is very important to better your education and find something your passionate about in life. † College can make you feel a lot of things. The major feeling is feeling stressed all the time. I asked Sandra how do you overcome stress in college? She replied manage your stress level and control your environment, by controlling who and what is around. Also, stay relax and enjoy yourself.My final question was is college worth the effort? Sandra answered college is a one time experience that can make a major impact on your future. To conclude, my sister has showed me that an education is very valuable and important. It allows me to reach my career goals. I would love to follow in my sisters footsteps in going to college. I want to learn what I want to learn and become what I love. Possibly being the second of our family to go to college would be a magnificent goal in my life. I want to succeed and be the best I can be.

Chikungunya virus Essays

Chikungunya virus Essays Chikungunya virus Essay Chikungunya virus Essay Abstraction The revival of Chikungunya virus ( CHIKV ) in several parts of Thailand runing from southern, northeast and North of Thailand with reported instances about 30,000 instances, get downing in October 2008 and ongoing until now ( November 2009 ) , has pointed out the public wellness concern. The chief clinical characteristics are onset of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia. The four about complete genome, representatives of 2008 and 2009, have been determined. Our survey shows that the closest related to the isolate in this eruption were the isolates from Kerela, South India of 2008 ( RGCB80, Accession No. GQ428212 ) demoing two coding part permutations: nsP2-L539S and E2-K252Q and the strain which predominant is ECSA strain, in contrast of the all old eruptions in Thailand which were Asiatic strain. Introduction Chikungunya Virus ( CHIKV ) is an enveloped, positive individual strand RNA virus with a genome of ? 11.8 kilobit [ 1 ] and belonged to the household Togaviridae and genus Alphavirus presently dwelling of 29 accepted members [ 2 ] . There is a 7-methylguanosine capped at the 5 terminal but a polyadenylated at the 3 terminal. The 5 two-thirds of the genomic RNA are responsible for the non-structural proteins. While the 3 tierce of the genomic RNA serves as the messenger RNA for the synthesis of the viral structural proteins [ 3, 4 ] . Harmonizing to the genomic organisation of other alphaviruses, the CHIK genome is acknowledged to be: 5 cap-nsP1-nsP2-nsP3-nsP4- ( junction part ) -C-E3-E2-6K-E1-poly ( A ) 3 . Alphaviruss have conserved sequences at the 5 and 3 terminals every bit good as the intergenic part. Among alphaviruses, conserved repeated sequence elements ( RSEs ) are besides observed in the 3 nontranslated part ( NTR ) . These conserved spheres play an of import func tion in the ordinance of viral RNA synthesis [ 5- 8 ] . CHIKV causes Chikungunya febrility ( CHIKF ) and chief clinical features include sudden oncoming of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia, which mostly affect the carpus, articulatio genus, mortise joint and little articulations [ 9 ] . The febrility about invariably precedes the roseola and joint hurting and has infrequently been reported as biphasic with return noted on the 4th or 5th twenty-four hours of unwellness [ 10, 11 ] . No studies of biphasic febrility were described during the 2005–2007 eruptions. In past eruptions, instances of feverish paroxysms in immature kids were besides reported [ 12 ] . Maculopapular and erythematous in character of the non-pruritic roseola is typically found and it will be seeable after infection for 2-5 yearss and may last up to 10 yearss. This roseola is distributed chiefly on the face, limbs and bole of the organic structure. Possibly the most important symptom of CHIKV infection is the te rrible articulation hurting that occurs with virtually every clinical instance [ 13, 14 ] . The patients who often reported disabling hurting that lasts for hebdomads or months have shown the articulations exhibiting enormous tenderness and swelling. Most infections wholly resolve within hebdomads or months but there have been documented instances of CHIKV-induced arthralgia prevailing for several old ages with up to 12 % of patients with CHIKV disease developing chronic articulation jobs [ 15- 17 ] . CHIKV was foremost described from the serum of a fevered homo during an eruption in Tanganyika ( now Tanzania ) in 1952–1953 during an epidemic of dengue-like unwellness [ 10 ] . Serologic and antigenic word picture of the isolates suggested that it was an alphavirus closely associated to Mayaro and SFV, while the initial appraisal was that the eruption was because of a dandy fever virus [ 18, 19 ] . Retrospective instance reappraisals have proposed that CHIKV epidemics occurred every bit early as 1779 but were often described inaccurately as dandy fever outbreaks [ 20 ] . During the sixtiess and 1990s, the virus was determined repeatedly from several states in Central and Southern Africa including Sudan, Uganda, Democratic Republic of Congo ( DRC, officially Zaire ) , the Cardinal African Republic ( CAR ) , Malawi, Zimbabwe, Kenya and South Africa. CHIKV has besides been isolated in western African states including Senegal, Benin, the Republic of Guinea, Cote dIvoire and Nige ria [ 21 ] . The virus is believed to hold originated in Africa and later was introduced into many parts of Asia [ 20 ] . Phylogenetic analysis of the CHIKV genome based on partial E1 sequences has identified 3 line of descents ; West African, Asian and East, Central and South African ( ECSA ) lineages [ 22 ] . In Africa, the virus is maintained through a sylvatic transmittal rhythm between wild Primatess and mosquitoes such as Aedes luteocephalus, Aedes furcifer, or Aedes taylori [ 23 ] while in Asia has been an urban transmittal rhythm, typically found in dengue-endemic countries and transmitted from human to human mostly by Aedes aegypti and, to a lesser extent, by Aedes albopictus [ 24 ] . The first CHIKV isolation in Asia was in Thailand in 1958 [ 25 ] and so other eruptions have been documented including Cambodia, Vietnam, Laos, Myanmar, Malaysia, Philippines, and Indonesia [ 23 ] Beginning in 1986, CHIKV outbreaks resurged with major disease bunchs documented in Senegal in 1986 and 1996/1997 [ 24 ] , Ivory Coast in 1996/1997 [ 26 ] , DRC during 1998–2000 [ 27 ] , Indonesia in 2003 [ 28 ] . Outbreaks occurred about continuously during 2004–2007 with 100s of 1000s of reported instances and new geographical countries involved [ 21 ] such as Kenya in 2004, Comoros in 2005 [ 29 ] , several Indian Ocean islands, in 2005, and India, in 2006-2007, which was an eruption of unprecedented magnitude [ 30 ] . Cases were besides reported in Europe ( UK, Belgium, Germany, Czech Republic, Norway, Italy, Spain and France ) , Hong Kong, Canada, Taiwan, Sri Lanka and the USA ; these were straight associated with the return of tourers from India and affected islands of the Indian Ocean [ 31 ] . The prevailing Aedes species in Madagascar and Reunion islands during 2005–2006 and in India in 2006/2007 was Aedes Albopictus [ 32 ] . The spread of chikungunya into rural countries during the ulterior phases of eruptions in India farther confirmed the potency of Aedes albopictus mosquitoes in conveying CHIKV [ 33 ] . These alterations were coincident with the outgrowth of a strain holding an alanine to valine permutation at codon 226 ( A226V ) of the envelope 1 ( E1 ) cistron in Reunion Island [ 34 ] and India [ 35 ] . This mutant is known to increase the transmissibi lity of the virus by Aedes albopictus [ 36 ] . This incident has been documented with the equid avirulent, Venezuelan equine phrenitis subtype ID viruses, where every bit small as 7 amino acid alterations can make epidemic forms of the virus responsible for immense eruptions [ 37 ] . The late September to October 2008, CHIKF eruptions have arisen in many southern states of Thailand particularly in Narathiwat, the southernmost state. There are plentifulness of Aedes Albopictus, the vector for CHIKV, in the plantation country, the common country of southern Thailand, and CHIKV was isolated from Aedes Albopictus in this outbreak country every bit good [ 38 ] . The suspension of CHIKF may be due to failure to observe low degree, continued transmittal in worlds, peculiarly because the symptoms may be mistaken for dandy fever febrility plus there is no accredited vaccinum or specific drug therapy available to bring around the unwellness, intercession relies upon vector control and minimising mosquito-human contact. Although there are several complete genomes of CHIK available in GenBank, the complete nucleotide sequence of CHIK distributing in Thailand is non available. In this survey, we conducted the about complete nucleotide sequence of virus isolated from four serum in 2008 and 2009, from Narathiwat state, the southernmost of Thailand and Bangkok where forbearance returned back from Nakhonsrithammaraj, the South of Thailand, inside informations were provided in table 1. In add-on, the phyletic beginning and the diverseness of the CHIKV strains responsible for reemergence in Thailand are besides considered. Method RNA extraction and RT-PCR CHIKV have been isolated straight from the patient s sera or from cell civilization which came from Vero cell at the first transition and the inside informations of sample were provided in table 1. Viral RNA were extracted by Viral Nucleic Acid Extraction Kit ( RBC Bioscience, Taiwan ) harmonizing to maker s process followed by contrary written text polymerase concatenation reaction ( RT-PCR ) utilizing Superscript III Pt One-Step Quantitative RT-PCR System ( Invitrogen, Carlsbad, CA, USA ) . A reaction mixture consisted of 2 ?l of extracted RNA, 5 ?l of 2x reaction mixed, 0.1 ?l of superior contrary RNA polymerase III Pt Taq polymerase, 0.5 ?M of each primer, and 6 ?l with nuclease-free H2O. The RT measure and PCR elaboration were performed in a Eppendorf Mastercycler personal ( Eppendorf, Hamburg, Germany ) at one time under the undermentioned conditions: contrary written text at 50 C for 30 min ; later initial denaturation at 95 C for 3 min ; followed by 40 rhythm of denaturation at 95 C for 1 min, primer tempering at 55 C for 1 min, and extension at 72 C for 1.30 min ; and concluding extension at 72 C for 7 min. All primers were used as show in table 2 which was designed towards S27 strains ( GenBank accession no. AF369024 ) [ 35 ] . Then the amplified PCR merchandises were analyzed by cataphoresis with 2 % -agarose gel in TBE buffer and stained by ethedium bromind, the expected set for the merchandise were visualized under UV visible radiation, excised from the gel and purified with the QIAquick Gel Extraction kit ( RBC Bioscience, Taiwan ) following the maker s instructions. The purified PCR merchandises were so used for direct sequencing by First BASE Laboratories SDN BHD ( Selangor Darul Ehsan, Malaysia ) . Table 1 Sample inside informations used in this survey sample codification day of the month of aggregation topographic point GenBank Acc No sample type CU-Chik661 2009 Narathiwat biological sample CU-Ckik009* 2009 Capital of thailand biological sample CU-Ckik10 2008 Narathiwat biological sample CU-Chik683 2009 Narathiwat virus isolate *patient returned from Nakhonsrithammaraj, the state in the South of Thailand. Table 2 Primers used for whole genome sequencing fragment cistron primer ( a ) Sequence ( 5 to 3 ) 1 5NC 18F CACGTAGCCTACCAGTTTCTTA nsP1 871R ATGGAACACCGATGGTAGGTG 2 nsP1 616F AACCCCGTTCATGTACAATGC nsP1 1435R CGGTACCACAAAGCTGTCAAAC 3 nsP1 1317F CACTGACCTGCTGCTGTCTATG nsP2 2130R AGTCCTGCAGCTTCTTCCTTC 4 nsP1 1412F CGAGTTTGACAGCTTTGTGGTA nsP2 2227R ATGACTGCAATTTTGTATGGGC 5 nsP2 1908F CAATCTCGCCTGAAGACTTCC nsP2 2709R TCCACTACAATCGGCTTGTTG 6 nsP2 2530F GTGCGGCTTCTTCAATATGATG nsP2 3343R TCCAGGCCTATTATCCCAGTG 7 nsP2 2577F AACATCTGCACCCAAGTGTACC nsP2 3504R GTCTCCTGTTGGCCGGTATAAT 8 nsP2 3332F TAATAGGCCTGGAGGGAAGATG nsP3 4134R CTACGCACTCTTCATCGTTCTT 9 nsP2 3885F GAACGAGTCATCTGCGTATTGG nsP3 4725R ATATCTCTGCCATATCCACTGC 10 nsP3 4458F TCTTTACAGCCATGGACTCGAC nsP4 5874R TCTACTTTGCGCGACTGATACC 11 nsP4 5630F CCCAGTATTCTTGGTTGCATG nsP4 6380R AAAACAGCACGCTTACCACG 12 nsP4 6184F AAAACAGCACGCTTACCACG nsP4 6936R AACTTGAAGCGCGTACCTGTC 13 nsP4 6732F TCATAGCCGCACACTTTAAGC nsP4 7495R AGGACCGCCGTACAAAGTTAC 14 nSP4 7278F GCAGGTGACGAACAAGATGAG C 8034R CCGCTTAAAGGCCAATTTG 15 C 7910F TCGAAGTCAAGCACGAAGG E2 8670R GTCTGTCGCTTCATTTCTGATG 16 E3 8459F TGCTTGAGGACAACGTCATGAG E2 9240R TTTGTGATTGGTGACCGCG 17 E2 9093F AGTCCGGCAACGTAAAGATCAC 6K 9861R AAAGGTTGCTGCTCGTTCCAC 18 E2 9648F AGTTGTGTCAGTGGCCTCGTTC E1 10403R TAAAGGACGCGGAGCTTAGCTG 19 E1 10145F ACAAAACCGTCATCCCGTCTC E1 11158R TGACTATGTGGTCCTTCGGAGG 20 E1 10959F CAGCAAGAAAGGCAAGTGTGC 3NC 11802R CTCCTACGTCCCTGTGGG The primers for the fragment 1-19 and the forward primer for fragment 20 are used from the published primers [ 36 ] and the contrary primer for fragment 20 was designed in this survey. Assembly of Genome Sequences and Sequence Analysis The genome sequences were analyzed utilizing the BLAST plan available in GenBank ( hypertext transfer protocol: //blast.ncbi.nlm.nih.gov/Blast.cgi ) . Then they were edited and assembled by utilizing CHROMASLITE ( v.2.0 ) and SeqMan ( DNASTAR, Madison, Wis. , USA ) . All sequences were aligned by utilizing Clustal X version 1.83 and phyletic trees were constructed utilizing the neighbor-joining method and Kimura s two-parameter with 1,000 bootstrapping method implemented in MEGA3.1 plan. Consequence Complete genome analysis of CHIKV in Thailand We determined the about full-genome sequences of four CHIKV isolates which were representatives of 2008 and 2009 in Thailand and the inside informations are provided in table1. The lengths of genome sequence of four isolates presented in this paper were 11,811 base brace except isolate CU-ChiK661 was 11,738 base brace. Every isolates shared the same length of big two ORF ; non-structural part 7422 bases ( 2,474 aa ) and structural part 3744 bases ( 1248 aa ) and besides shared 65-nucleotide junction between these two open reading frame excepting stop codon of the non-structural of unfastened reading frame and get down codon of the structural unfastened reading frame. The 5UTR ended at nucleotide place 62 for CU-ChiK661 and 76 for others. The 3UTR part started at nucleotide place 11,299 for CU-ChiK661 and 11,314 for others. Then they were aligned with complete 23 genome sequences available in GenBank. Overall, genome constructions of these four isolates were consistent with old work [ 41 ] . The isolates in this survey were found really closely related demoing 99.79-99.89 % individuality with one another and had an mean whole genome nucleotide individuality of 97.0 % with the S27 paradigm. The isolate which were near related with our isolates was the isolate from Kerala, South India: RGCB80, Accession No.GQ428212 demoing an mean 99.72 % individuality. The most closely related to S27 paradigm CU-Chik661 was the closest one to S27 strain. In the non-structural part showed 34 aa alteration ( 1.37 % ) lined in nsP1 nine aa alteration ( 1.68 % ) , nsP2 6 aa alteration ( 0.75 % ) , nsp3 11 aa alteration ( 2.07 % ) , and nsP4 7 aa alteration ( 1.14 % ) . The nsP3 showed the highest ratio alteration while the nsP2 showed the lowest ratio alteration which correlated with old survey [ 36 ] . When it comes to structural part, ChiK661 exhibited 25 aa alteration ( 2.00 % ) arranged in C 3 aa alteration ( 1.15 % ) , E3 1 aa alteration ( 1.56 % ) , E2 15 aa alteration ( 3.55 % ) , 6K 2 aa alteration ( 3.27 % ) , and E1 4 aa alteration ( 0.91 % ) ( table3 ) . Table 3 Comparison of amino acerb permutations identified in Thailand with that of S27 and other Indian isolates in 2007 and 2008 Region polypeptide place pritein place S27 RGCB80/KL07 RGCB356/KL08 ChiK 661 Chik 9 Chik 10 Chik 683 nsp1 29 29 Phosphorus . . . . Second . 105 105 Gram . Roentgen . . . . 128 128 Thymine K K K K K K 172 172 Liter Volt Volt Volt Volt Volt Volt 186 186 Nitrogen . . . . Calciferol . 234 234 Tocopherol K K K K K K 256 256 Tungsten . Roentgen . . . . 376 376 Thymine Meter Meter Meter Meter Meter Meter 383 383 Meter Liter Liter Liter Liter Liter Liter 384 384 I Liter Liter Liter Liter Liter Liter 481 481 Thymine I I I I I I 488 488 Q Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 507 507 Liter Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 531 531 Calciferol Gram . . . . . nsp2 583 48 Volt A . . . . . 589 54 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 614 79 Phosphorus . . . . Second . 716 181 Volt A . . . . . 864 329 K Tocopherol . . . . . 909 374 Hydrogen Yttrium Yttrium Yttrium Yttrium Yttrium Yttrium 1074 539 Liter Second Second Second Second Second Second 1117 582 C Yttrium Yttrium Yttrium Yttrium Yttrium Yttrium 1118 583 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 1328 793 A Volt Volt Volt Volt Volt Volt nsP3 1428 95 K Q . . . . . 1508 175 Volt I I I I I I 1534 201 Second . Gram . . . . 1550 217 Yttrium Hydrogen Hydrogen Hydrogen Hydrogen Hydrogen Hydrogen 1659 326 Phosphorus Second Second Second Second Second Second 1664 331 Volt A A A A A A 1670 337 Thymine I I I I I I 1671 338 Thymine . . . . Meter . 1685 352 K Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 1709 376 I Thymine Thymine Thymine Thymine Thymine Thymine 1715 382 A Thymine Thymine Thymine Thymine Thymine Thymine 1794 461 Liter Phosphorus Phosphorus Phosphorus Phosphorus Phosphorus Phosphorus 1795 462 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 1804 471 Phosphorus Second Second Second Second Second Second nsP4 1938 75 Thymine A A A A A A 1945 82 Roentgen . . . . Roentgen . 1950 87 Yttrium . . Hydrogen . . . 2117 254 Thymine A A A A A A 2157 294 Volt A . . . . . 2363 500 Q Liter Liter Liter Liter Liter Liter Region polypeptide place pritein place s27 RGCB80/KL07 RGCB356/KL08 ChiK 661 Chik 9 Chik 10 Chik 683 nsP4 2377 514 I Thymine Thymine Thymine Thymine Thymine Thymine 2418 555 Volt I I I I I I 2458 595 Nitrogen . . . . K . 2463 600 Roentgen . . . . I . 2467 604 Volt I I I I I I 2468 605 Thymine . . . . Second . 2469 606 Liter . . . . Meter . mirid bug 23 23 Phosphorus Second Second Second Second Second Second 27 27 Volt I . I I I I 28 28 Roentgen . Thymine . . . . 63 63 K Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen E3 284 24 I Thymine Thymine Thymine Thymine Thymine Thymine 290 30 K . . . Roentgen . . E2 382 57 Gram K K K K K K 399 74 I Meter Meter Meter Meter Meter Meter 404 79 Gram Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 409 84 F . . . Liter . . 485 160 Nitrogen Thymine Thymine Thymine Thymine Thymine Thymine 489 164 A Thymine Thymine Thymine Thymine Thymine Thymine 506 181 Liter Meter Meter Meter Meter Meter Meter 519 194 Second Gram Gram Gram Gram Gram Gram 536 211 I Thymine Thymine Thymine Thymine Thymine Thymine 554 229 Volt . I . . . . 576 251 Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 577 252 K Q . Q Q Q Q 592 267 Meter Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 624 299 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 632 307 Q . . . Roentgen . . 637 312 Thymine Meter Meter Meter Meter Meter Meter 669 344 A Thymine Thymine Thymine Thymine Thymine Thymine 675 350 Gram . Second . . . . 700 375 Second Thymine Thymine Thymine Thymine Thymine Thymine 711 386 Volt A A A A A A 6K 756 8 Volt I I I I I I 802 54 I Volt Volt Volt Volt Volt Volt 813 65 Volt . A . . . . E1 1035 226 A Volt Volt Volt Volt Volt Volt 1078 269 Meter Volt Volt Volt Volt Volt Volt 1093 284 Calciferol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 1113 304 Phosphorus . Liter . . . . 1131 322 Volt A A A A A A 1242 433 C Roentgen . . . . . Non-structural part Compared to S27 and, the CU-Chik661, CU-Chik009, CU-Chik10 and CU-Chik683 isolates have shared 26 permutations in the non-structural part: nine in nsP1 ( T128K, L172V, E234K, T376M, M383L, I384L, T481I, Q488R, and L507R ) , five in nsP2 ( S54N, H374Y, C582Y, S582N, and A793V ) , eleven in nsP3 ( V175I, Y217H, P326S, V331A, T337I, K352E, I376T, A382T, L461P, S462N, and P471S ) and six in nsP4 ( T75A, T254A, Q500L, I514T, V555I, and V604I ) as shown in table3. Most of these alterations were besides found in other isolates from Indian Ocean and Reunion isolate in 2006 and 2007, isolates from Kerala, South India in 2006-2008 and other parts of the universe. Interestingly, there was opal stop codon ( UGA ) at nsP3 codon 524 in the present isolates while S27 and Ross were non. This opal halt codon was besides observed in related alphavirus and old reported CHIKV isolates every bit good [ 35 ] . It is believed to modulate the look of nsP4, the putative RNA polymerase, by read-through mechanism [ 2, 39 ] Additional particular alterations were besides observed in ChiK10 ( nsP1-P29S, nsP1-N186D, nsP2-P79S, nsP3-T338M, nsP4-N595K, nsP4-R600I, nsP4-T605S, and nsP4-L606M ) and ChiK661 ( nsP4-Y87H ) . There was besides alone nucleotide permutation to the CU isolate which was non-synonymous alteration A6811G lined in nsP4 part. Structural part When analysing the amino acerb alteration of the structural protein 24 place were found to be common for the four isolates: three in C ( P23S, V27I and K63R ) , one in E3 ( I24T ) , 15 in E2 ( G57K, I74M, G79E, N160T, A164T, L181M, S194G, I211T, K252Q, M267R, S299M, T312M, A344T, S375T, and V386A ) , two in 6K ( V8I and I54V ) and four in E1 ( A226V, M269V, D284E, and V322A ) The lone one isolate which had specific alteration was ChiK009 demoing three specific aa place alterations ( E3-K30R, E2-F84L and E2-Q307R ) At the nucleotide place 9138, there was a alone event to the CU isolate demoing the same base as S27 and Ross strain while the remainder of other sequences antecedently reported had changed from T to C. 5 and 3 NTRs The 5 NTR of all four isolates were found to portion similarity with one another uncovering the mutant at place 68 from G to T in comparing to S27 which were besides detected in all the recent isolates. Merely did CU-Chik10 hold a mutant at nucleotide place T64A. There was no interpolation or omission has been observed. Within the 3UTR, sequences in this survey revealed the omission of a stretch 14 bases of 19 bases at place 11,369-11,342 compared to S27 except CU-Chik661 showed merely one A omission. This 14-A losing events besides showed in 2006 Indian Ocean isolates [ 35 ] . Phylogenetic analyses Fig.A1 illustrated the phyletic tree base on full genome analysis. CU isolates ( CU-Chik009, CU-Chik10, CU-Chik683 and CU-Chik661 ) arranged closest to isolates from Kerala, South India. Furthermore, they were crusted together with isolates during 2006 reunion eruption and 2007-2008 Indian eruption and related isolates. We besides determine extra E1 partial genome to analyse phyletic beginning as it is of import in phyletic analysis and there is more available sequence of this part including Asiatic and West-African strain. The phyletic tree based on E1 partial genome displayed in fig.A2. It revealed that all isolates in this survey were grouped in ECSA phylogroup. This determination was non the same phylogroup doing the eruption in 1958 in Thailand which was assigned in Asiatic strain. Discussion The first CHIKV described in Thailand was in 1958 in Bangkok [ 25 ] which was subsequently confirmed to be an Asiatic strain. [ 22 ] After that there were still a cyclicity of outgrowth of CHIKV in Thailand demoing a spread of 2-18 old ages: Prachinburi ( 1976 ) , Surinn ( 1988 ) , Khon Khen ( 1991 ) , Loei and Prayao ( 1993 ) , and Nongkhai and Nakorn Sri Thammaraj ( 1995 ) . During those outgrowths, the CHIKV all happened to be Asiatic strain [ 22 ] . CHIKV is presently doing one of the big eruptions reported in the past 50 old ages as in October 2008, bunch of febrility, roseola and terrible arthralgia was detected in one small town at Laharn wellness centre in Narathiwat and so chikungunya was suspected and confirmed subsequently. CHIKV has been distributing to next state of Narathiwat and the close state including Songkhla, Pattani and Yala by detecting several thousand instances reported in each country. Not merely has CHIKV been administering in the nearby country of Narathiwa t but besides go arounding in the other parts of Thailand including sou-east, cardinal, north and E of Thailand demoing more than 30,000 septic instances. The chief factor of distributing across the country is believed to be importing by travellers. This magnitude of the epidemics has arisen concernment of the public wellness of Thailand. As CHIKF was non a notifiable disease in Thailand, therefore the Bureau of Epidemiology had included CHIKF is the latest notifiable disease and launched in November 2008 ( inactive surveillance countrywide ; all gov. infirmaries and some private ) [ 40 ] . This survey revealed the high degree of preservation of this RNA virus within a peculiar eruption that has been of considerable involvement during the patterned advance of 2008-2009 Thailand epidemics. As observed in old findings of samples collected during an on-its-own eruption, isolate sequences showed merely rare alterations stand foring expected degrees of familial impetus connected with an RNA genome. However, some given mutants were identified that may hold an association with samples collected from patients stand foring more terrible unwellness. Our survey represents the first analysis, to our cognition, of intra-outbreak of CHIKV in Thailand of the molecular degree. Our phyletic analyses placed on partial glycoprotein E1 sequences confirmed that CHIKV distributing in Thailand was caused by the same strain on Reunion, Seychelles, Mayotte, Madagascar, Mauritius, Indian Ocean, and India, and showed that this strain is related to East- , Central- and South-Africa isolates non th e Asiatic strain as old eruption in Thailand. In add-on, E1-226 was the lone genotype observed during this eruption. Previous surveies showed that the mutant of amino residue 226 of E1 genome of SFV was observed to let go of the cholesterin dependance of the virus [ 41, 42 ] which might convey an advantage to virus in mosquitoes which are cholesterin auxotrophs, therefore CHIKV might hold the favour from this mutational alteration every bit good. From all sequence of CHIKV except S27 and Ross strains have shown opal halt codon ( UGA ) at nsP3 codon 524. Restricting the figure of transitions is the key because the infecting viral population may maintain up a correspondence to a quasispecies [ 43, 44, 45 ] . Repeated in vitro transitions could move as a filter on this population. For case, the presence in S27 of an Arg codon alternatively of the opal halt codon in other isolates is possibly explained by legion in vitro transitions of S27, as development of opal to Arg was observed by experimentation in ONN viruses [ 46 ] There is no aminic acid alteration detected among this eruption that is unambiguously associated with the Central/East African genotype from which the strain doing the 2008-2009 epidemics evolved. However, there are two alterations, one at the nsP2-L539S and one in the E2-K252Q that about alone to these isolates irrespective of three isolates from Kerala, South India, either alteration alters the hydrophobicity and charge of the amino acid incorporated but the biological relevancy of these alterations can merely be speculated. Chik10 had revealed the most alterations compared to three isolates and Chik10 was the lone sample collected in 2008 and it had specific alterations that have nt shown in other isolates. Therefore those alterations might non remain circulate in this eruption or it was non the strain which predominate. Although CHIKV eruption has happened in Thailand since 2008, it is still ongoing circulate in several parts of Thailand so the farther probe should be considered.

Term Paper Format

Term Paper Format Term Paper Format Term Paper Format There are many different types of terms papers and every tutor has his own formats and conventions. In your field of study, you will need to find out exactly what the accepted term paper conventions are. Note that these conventions may vary from one subject to the next. While writing a term paper, you will have to use different sources. If you do a good job with your research now, you may not have to do extra research later. Choose an original and interesting topic for term paper writing. Remember, if two term papers will have the same topic, be sure these two papers will be compared and examined very closely. While writing a term paper, choose the most direct way to express your point. Using too many words can be a greater problem than using the wrong word. Term Paper Format Tips Before writing a term paper, you probably will be assigned to use one of the term paper styles. You may be assigned either APA or MLA style term paper. While writing a term paper, examine the assigned style. Be sure that teacher will take into account your proper use of format. The term paper should have a title in the center of the first page. Pagination should start with the second page. Introduction, thesis statement, body paragraphs and conclusion are the essential part of the term paper writing. Use transitional sentences between the paragraphs You must not use first person 'I' or 'we'  or second person 'you' unless allowed by your teacher. Remember that term papers are written in a formal style. This does not mean that they have to contain long and difficult words, but rather that they do not contain contractions e.g: isn't, won't etc. Use Time New Roman or Arial font, 12 point, double-spaced format. Term paper topics mustn't have such words as 'how to'. The term paper should have at least 5 cited sources. If you paraphrase some information make sure that paraphrase has the same meaning as conveyed by the author. Change not only the sentence structure, but also the words. Give a reference to the author whom you are paraphrasing with both an in-text and reference page citation. If it is necessary, use integrating verbs. Be sure that your sentences sound natural. Paraphrase at least 70% of the time and don't forget to use scientific writing style. Cheek the term paper carefully for mistakes, it shouldn't have handwritten corrections. Custom Written Term Papers Term paper writing has a significant impact on your final grade for the course.   Many students believe that writing something is enough to get a good grade. This is a wrong assumption - writing something is not enough because your term paper is graded for clarity of idea expression, proper format, detailed referencing, and full coverage of the topic.   We offer you to use professional term paper writing help to ensure high grade.   We know what a good term paper is and we know how the great term paper is written.

Free Essays on Nature Vs Nurture

, â€Å"Nature makes the boy toward, nurture sees him forward.† Even though nature plays a role in defining sex and gender, nurture plays the greater part in helping society define the two terms. Definitions come from that which is learned, not that which is part of our genetic system. John Locke believed that all people were born with a blank slate (a tabula rasa.) Him and other Empiricists thought that experiences were written into the mind and that every aspect of human behavior is acquired from the environment that surrounds them. Take for example the story which Susan Baxter tells in her article ‘The Last Word on Gender Differences† of the boy who was castrated at birth and raised as a girl. â€Å"Amazingly, this boy had an identical twin brother, which made it possible to compare two genetically identical individuals raised as a boy and a girl... our hero became the perfect little girl, the very picture of adorable femininity.† (Baxter 52) This boy was clearly raised as a girl and he grew up thinking of himself as a girl. He was not born as a female and he did not have a predetermined image of himself as one. This boy grew up as a girl because throughout his life he was told that he ... Free Essays on Nature Vs Nurture Free Essays on Nature Vs Nurture One of the most controversial debates of modern society is the idea that our â€Å"natures† and how we are nurtured are in conflict with each other to determine what defines who we are. When one attempts to define sex and gender, he/she often finds him/herself stumped as to what the definitions are. More so, one is puzzled by where the came from. How do nature and nurture influence the definitions of sex and gender? To understand how nature and nurture affect these definitions, we must first know what they are. Sex is biological while gender is socially constructed. Genes produce sex. It exists in itself, and is sublimely indifferent to what humans think of it. Gender is the meanings that society assigns to sex. Richard Mulcaster wrote the words, â€Å"Nature makes the boy toward, nurture sees him forward.† Even though nature plays a role in defining sex and gender, nurture plays the greater part in helping society define the two terms. Definitions come from that which is learned, not that which is part of our genetic system. John Locke believed that all people were born with a blank slate (a tabula rasa.) Him and other Empiricists thought that experiences were written into the mind and that every aspect of human behavior is acquired from the environment that surrounds them. Take for example the story which Susan Baxter tells in her article ‘The Last Word on Gender Differences† of the boy who was castrated at birth and raised as a girl. â€Å"Amazingly, this boy had an identical twin brother, which made it possible to compare two genetically identical individuals raised as a boy and a girl... our hero became the perfect little girl, the very picture of adorable femininity.† (Baxter 52) This boy was clearly raised as a girl and he grew up thinking of himself as a girl. He was not born as a female and he did not have a predetermined image of himself as one. This boy grew up as a girl because throughout his life he was told that he ... Free Essays on Nature Vs Nurture Abstract Nature vs. nurture has been discussed by philosophers in the past and by scientists most recently. Philosophers such as Plato argued that all knowledge was inherited through your parent and when you were told something you didn’t learn it you were just reminded of it. Aristotle however argued that all humans were born with a blank slate and built on it with influence from there environment. In the 1700’s the empiricists and the internalists took over the argument. They fought through letters explaining there point of views and denouncing the others. This leads to Pavlov coming up with the idea of behaviorism in the early 1900‘s. Behaviorism became the new wave of Psychology and influenced a lean towards the nurture side. It was not effectively argued against until 1928 when Watson published his book. This opened up the floodgates for environmental influences studies. Soon the idea of nurture was the popular excuse for behavior. Studies using animals were the most popular was in which scientists used to prove a theory, or disprove a theory. The newest studies use human twins to prove nature vs. nurture. An age-old question has been asked for generations before us. What is the reasons behind the development of human behavior? There have been many theories formulated to explain why humans behave the way they do. Explanations vary from demonology to magnetic fluids controlling people’s behaviors. Over time, two theories have remained popular in academic fields such as philosophy and psychology. The surviving theories for behavior stem from physiological and sociological explanations. However, the two explanations have not always been compatible with each other. The famous nature vs. nurture debate over human behavior resulted from conflicting views between proponents of the physiological (nature) and sociological (nurture) explanations. Throughout history, research has swayed popularity back and forth between the theo...

Is Openly Carrying Guns A Justifiable Act Essay Example | Topics and Well Written Essays - 750 words

Is Openly Carrying Guns A Justifiable Act - Essay Example The 2nd Amendment, which states, "a well regulated militia, being necessary to the security of a free state, the right of the people to keep and bear arms shall not be infringed" gives people the liberty to arm themselves with weapons for their own self-defense. This right is respected by some states to the extent that people should expose the guns they are carrying, so long as they were legally acquired. One camp, such as that of Virginia Citizens Defense League (VCDL) considers themselves responsible gun owners and claims that they do not use the gun until it is necessary. They believe that the sight of guns is enough to dispel any untoward incidents by criminals. Because of this, so many people were enticed to buy guns for themselves. VCDL’s issuance of gun permits increased dramatically from 3,000 in 1994 to 180,000 in 2009. However, some people may not react positively to this since guns are very tempting to just use at one’s whim if that individual is impulsive. I t may go off accidentally hurting even the owner, or someone within peripheral distance. If the gun carrier is prone to temperamental outbursts, then it is worse, since if he is provoked, then he has his gun to vent his temper with. Responsible gun owners are aware of this and vehemently deny that they are that weak. They even advocate for the law of first investigating the background of whoever wants to buy a gun before releasing it to just anyone who may have the impulse to use it any which way he wants. This is where people call upon the 14th Amendment. It is clearly stated in Section one of this amendment that: â€Å"No State shall make or enforce any law which shall abridge the privileges or immunities of citizens of the United States; nor shall any State deprive any person of life, liberty, or property, without due process of law; nor deny to any person within its jurisdiction the equal protection of the laws†. This amendment, or Incorporation Doctrine, advocates the Bi ll of Rights to balance off whatever laws that may override the rights of others. In this case, the 2nd Amendment may give the right to people to â€Å"bear arms† however, it should also respect the rights of others who do not advocate gun ownership in the belief that it is not necessary. This conflict causes a huge confusion that may leave people divided, and the government, in a â€Å"fence-sitting† position. President Obama was known as the most anti-gun president. NRA or National Rifle Association protested against him for gun control laws. Obama’s stand was that guns are harmful and should not be openly carried even if it is licensed in order to prevent it from firing at anyone, whether intentionally or not. The NRA organization claims that its members are responsible gun owners who are discerning about gun use and are against loosely selling firearms to just about anyone. Seven states have ruled that any gun manufactured in their state is exempt from gun c ontrol laws. This implies no background checks, no age restrictions, no requirements for sellers to check out before releasing guns to buyers. This is their interpretation of the second amendment right. This ruling may be abused by some people who may claim that the gun they own was manufactured in that state, hence they do not have to go through thorough background check before being issued a permit. The federal government may also be suspected of concealing weapons so that these would be exempt from gun control laws because Obama has not done anything regarding NRA’s protest, and seems apathetic to the issue. Personally, I am not in favor of the Open Carry gun policy of some states. I do respect their belief of

Essay about a visual art Example | Topics and Well Written Essays - 750 words

About a visual art - Essay Example The understanding of the painting is, therefore, universal (Fiero, p. 45). The painting was originally identified as the work of Lorenzo di Pierfrancesco in 1500s. It was however after a serious consideration of the characteristics of the paintings and related them to the paintings of the time, and historians have identified that the painting dates back to around 1485-87. The design of the paintings has, therefore, been associated with the work of Sandro Botticelli. The painting has a rich historical presentation that is stored in its design and style. It depicts the breezes and the winds that bring forth Venus, the goddess of love who rises from the sea to the mainland (Fiero, p. 45). The Platonic perception of Venus is seen in two aspects. First, she is an earthly goddess who caused the physical arousal to physical love and human affection. Secondly, she is also seen as the heavenly goddess who inspires and develops intellectual love inside the people who recognize her. According to the teachings of the Platonic Academy, the induced contemplation of physical beauty and love increases the chances that the person will understand spiritual beauty. This implies that Venus, being the goddess of love uses the physical attraction to lift the mind towards something greater. As such, the importance of this painting has currently been used by religion to depict that physical beauty and attraction should lift minds towards the creator ((Frank, pp. 85-90). The Birth of Venus depicts Venus, born from the sea and arising as a nude statue that is floating on a sea shell. From the West, Venus is blown by Zephyr, the West wind. The nymph, Chloris is at the shore prepared to dress Venus in a beautifully flowered mantel. The artist uses a fully committed naturalism style in which he has employed the use of space and representations of natural phenomena, sea, wind and flowers to increase the fantasy. The blowing of the winds that

Anthropology Essay Example | Topics and Well Written Essays - 500 words - 1

Anthropology - Essay Example The investigation of any culture must be implemented carefully and without any preferences in order to define the most important peculiarities of each of them. Traditionally, cultural relativity used double hypothetical method called historical particularism. The term implies that any culture must be studied deeply. This inference is very important not only for anthropology but also for other sciences (Zechenter, 1997). The strong point of  cultural  relativity is that it lets people stick to their ethical principles without being judged by other communities, which have other principles. If people deny this method, they will appear in difficult situation: if they have constant unchanging moral rules, they criticize the communities with other values and maybe even try to make them adapt the moral rules of other community. That will make cross-cultural relations difficult (Zechenter, 1997). Cultural  relativity provides the opportunity to avoid this complexity. According to it, the ethical code of one group of people can be applicable only to their community, that’s why the communities can’t impose their moral standards upon each other. Really, every society has its own values which should be respected by peoples from other cultures (Flew, 1968). When a person comes to another country, he should respect the moral principles existing in this society, but it does not mean that he must adopt them. Every culture has its ethical values which are worth-studying and must be respected by other cultures in certain times (Zechenter, 1997). For example, for our society equal opportunities at work are an ethical requirement, however it is improper in other countries. In the times when patience is considered to be the most essential this can be called a good arrangement (Zechenter, 1997). Nevertheless, the abovementioned point of  cultural  relativity represents also

Five greatest U.S. presidents Essay Example | Topics and Well Written Essays - 1250 words

Five greatest U.S. presidents - Essay Example Such a benchmark should enable one to determine varying degrees of greatness based on the extent to which each President under consideration meets or exceeds it. For purposes of this study, which purports to rank the five greatest Presidents in the history of the United States, greatness is defined as having had a direct impact on setting the course of America toward what it is today. In other words, the greatest Presidents are those without whom America would not have become the country it has become. These leaders each fundamentally altered the course of evolution of America, for better or worse, and thereby have heavily influenced present-day American life by way of their leadership. This being a top-five list out of forty-three possible choices, it need not imply that those who did not make the list were not great Presidents. Rather, the following five American Presidents were arguably the most influential in shaping America of all of the greatest and most influential leaders in American history, of which there were surely more than five. They are, in order of greatness: Franklin Roosevelt, George Washington, Abraham Lincoln, Harry Truman, and Bill Clinton. Franklin Delano Roosevelt was arguably the greatest American President in history. ... me and abroad, much less did so as effectively and with such positive results and while suffering from the effects of a ravaging disease (Coggan, 2003). Roosevelt led the nation with such a firmness of purpose and confident assurance that he was able to rally and inspire Americans to sacrifice in the name of a greater good for as long as it would take to achieve victory. The Great Depression was Roosevelt's first great test. Never before had the nation known such economic despair, nor lost confidence to such an extent in America's capitalist underpinnings. For the first time, the unfettered marketplace rolled over to reveal its vulnerable underbelly, and it was shocking to see how exposed it was. By the time Roosevelt entered the Oval Office, America was in the midst of a full-blown crisis that threatened its very fabric. Roosevelt reassured the nation through his "Fireside Chats" in a way that no previous President had ever before communicated with the country. He quickly went to work to craft and implement legislation that reestablished confidence in America's stock market, banking system and other capitalist institutions. He established public works programs that reemployed hundreds of thousands of laid off workers. Further, he Americanized the concept of social welfare with programs such as Social Security that peacefully coexisted with a free ma rket system. Roosevelt also led America into World War II, delivering one of the most inspirational rallying speeches in American history in the wake of the Japanese bombing of Pearl Harbor. His leadership was largely responsible for the Allied victory, and catapulted America toward its Post War Superpower status that it still retains to this day. Roosevelt essentially led the world in its greatest struggle against evil and

Professional Perspectives Essay Example | Topics and Well Written Essays - 750 words

Professional Perspectives - Essay Example The main objective of co-educators is to ensure that a group heterogeneous student understands instructions effectively (Perez, 2012). Contrariwise, co-educators differences results to lack of collegial interactions of strategies, which leads to a poor instructional program. Philosophy Statement on Co-Teaching It is hard for co-educators to meet diversified students’ needs with differing professional perspectives, which negatively affect professional interactions in the development of effective strategies to ensure that all student needs are satisfied including those with disabilities. A colleague with a different perspective from mine will be of more disadvantages than advantages in terms of collegial support towards meeting student needs and formulation of effective strategies. I am profound on the professional interactions as well as my co-educator’s characteristics and needs. The concepts of an effective exchange of plans and consultation in implementing a curriculu m that gratifies all student needs are central to my philosophy of co-teaching. Collegial support that offers a different input towards my plans demonstrates the absence of diversity based teamwork towards a long lasting co-teaching (Specialconnections.ku.edu, n.d.). I believe that co-teaching has to involve a number of co-teachings activities such as exploring skills that educators require to collaborate successfully. However, in a case whereby my co-educator differs with every slight perception I have towards a learning environment, it is challenging to implement co-planning in a classroom. I love learning new things, and it would be god of my o-educator to equip me with new instructional techniques. Nonetheless, my co-educator has to assimilate my perspectives and together develop strategies towards effective co-teaching opposed to a situation where none of our professional perspective is common. I believe that adaptability, dedication, collaboration, and positive collegial suppo rt are the key aspects towards effective consultations on issues affecting students because of diversity rather than focusing on the differences that may exist between my co-educator and me. Different professional perspectives should be utilized as a tool of every co-educator self-reflection to realize his/her weakness and strengths concerning the ability to work as teamwork (Perez, 2012). The success of an inclusive classroom depends on the parity portrayed by the partnership of both educators, which must show the presence of a teaching practice based on effective collaboration and support. Viewpoint Description on Co-Teaching The most important aspect for effective consultations in handling students’ needs in co-teaching is the partnership between two co-educators. Each co-educator perspective on co-teaching is a complicated set of actions and intentions with unique criteria for evaluating strategies that are right and wrong. Our roles and the idealized self-image as co-edu cators are determined professional perspectives. Moreover, perspectives provide the basis to which co-educators can reflect on the co-teaching practice (Beninghof, 2012). The moment I consult with a co-educator who believes as I do, an immediacy of communication is established as well as the feeling of being understood. However, a colleague that believes in a truly different way from mine evokes a

Five greatest U.S. presidents Essay Example | Topics and Well Written Essays - 1250 words

Five greatest U.S. presidents - Essay Example Such a benchmark should enable one to determine varying degrees of greatness based on the extent to which each President under consideration meets or exceeds it. For purposes of this study, which purports to rank the five greatest Presidents in the history of the United States, greatness is defined as having had a direct impact on setting the course of America toward what it is today. In other words, the greatest Presidents are those without whom America would not have become the country it has become. These leaders each fundamentally altered the course of evolution of America, for better or worse, and thereby have heavily influenced present-day American life by way of their leadership. This being a top-five list out of forty-three possible choices, it need not imply that those who did not make the list were not great Presidents. Rather, the following five American Presidents were arguably the most influential in shaping America of all of the greatest and most influential leaders in American history, of which there were surely more than five. They are, in order of greatness: Franklin Roosevelt, George Washington, Abraham Lincoln, Harry Truman, and Bill Clinton. Franklin Delano Roosevelt was arguably the greatest American President in history. ... me and abroad, much less did so as effectively and with such positive results and while suffering from the effects of a ravaging disease (Coggan, 2003). Roosevelt led the nation with such a firmness of purpose and confident assurance that he was able to rally and inspire Americans to sacrifice in the name of a greater good for as long as it would take to achieve victory. The Great Depression was Roosevelt's first great test. Never before had the nation known such economic despair, nor lost confidence to such an extent in America's capitalist underpinnings. For the first time, the unfettered marketplace rolled over to reveal its vulnerable underbelly, and it was shocking to see how exposed it was. By the time Roosevelt entered the Oval Office, America was in the midst of a full-blown crisis that threatened its very fabric. Roosevelt reassured the nation through his "Fireside Chats" in a way that no previous President had ever before communicated with the country. He quickly went to work to craft and implement legislation that reestablished confidence in America's stock market, banking system and other capitalist institutions. He established public works programs that reemployed hundreds of thousands of laid off workers. Further, he Americanized the concept of social welfare with programs such as Social Security that peacefully coexisted with a free ma rket system. Roosevelt also led America into World War II, delivering one of the most inspirational rallying speeches in American history in the wake of the Japanese bombing of Pearl Harbor. His leadership was largely responsible for the Allied victory, and catapulted America toward its Post War Superpower status that it still retains to this day. Roosevelt essentially led the world in its greatest struggle against evil and

NYSEGs Corporate Responsibility Essay Example | Topics and Well Written Essays - 500 words

NYSEGs Corporate Responsibility - Essay Example This altruistic program conforms to Milton Friedman and R. Edward Freeman’s concept of attempting to satisfy the profits needs of the company as well as the social responsibility needs of the employees and other stakeholders. This shows that the company is not only concerned with maximizing profits from its operations but it also has a duty to be socially responsible to the people in the environment in which it is operating from. Friedman states that the executives of the company ought to operate profitably while at the same time fulfilling the needs of the stakeholders impacted by its operations. In this case, it can be observed that Project Share is designed to appeal to the customs laws or public policies which require the companies to give back part of their profits to the members of the society in which they operate. This program does not interfere with the operations of the organization since there are responsible people who handle issues related to donations of funds to different people while the managers in the company are expected to focus on their core business of generating profits for the firm. But I believe that NYSEG uses this program as a marketing gimmick where it seeks to maximize profits in the guise of corporate social responsibility citizenry. The customers and stakeholders are very important for the survival of the company according to the stakeholder theory advanced by Edward Freeman. All stakeholders including employees, managers, customers among others must be treated as valuable asserts.

Good conductors of electricity Essay Example for Free

Good conductors of electricity Essay EXPERIMENTAL PROCEDURES In order to record my observations, I will use the following types of observation tables, and I will display the manner in which my wire will be setup, in order that I will be able to experiment with them. 1. LENGTH For length, we have to make sure that only the length is changed, and that all the other factors are kept as a constant, i. e. the thickness, the material, and the temperature. Thickness = 0. 3 mm Material = nichrome Temperature = room temperature The index is adjusted, to vary the resistance, 10 alternative readings of current and voltage are taken, at uniform intervals. For every 0. 2 volts, I will be measuring the current, for each wire, and I will be observing, and recording the readings on the ammeter, in a table like this. SR. NO VOLTAGE CURRENT AVERAGE R= V / I IN VOLTS(V) INCREASING DECREASING CURRENT (? ) 1 0. 00 Xxx Xxx Xxx Xxx 80 X 11 2. 00 X TOTAL AVERAGE RESISTANCE = Xxxx My expected graphs will look like this. The shorter the wire, the lesser the resistance there will be. ? = 1/ gradient ? 20 cm wire has the greatest gradient, so less resistance. The resistance on should tally with my table readings; otherwise, it will mean that there is an error somewhere. 2. Thickness For thickness, we have to make sure that only the thickness is changed, and that all the other factors are kept as a constant, i. e. the length, the material, and the temperature. Length = 50 cm Material = nichrome Temperature = room temperature SR. NO VOLTAGE CURRENT AVERAGE R= V / I IN VOLTS(V) INCREASING DECREASING CURRENT (? ). 11 2. 00 X TOTAL AVERAGE RESISTANCE = Xxxx My expected graphs will look like this. The thicker the wire, the lesser the resistance there will be. ? = 1/ gradient ? 3 mm wire has the greatest gradient, so it has the least resistance. 3. Material For material, we have to make sure that only the material is changed, and that all the other factors are kept as a constant, i. e. the length, the material, and the temperature. Length = 50 cm Thickness = 0. 4 mm Temperature = room temperature SR. NO VOLTAGE CURRENT AVERAGE R= V / I IN VOLTS(V) INCREASING DECREASING CURRENT (?) TOTAL AVERAGE RESISTANCE = Xxxx My expected graphs will look like this. Different conductors have different resistances, thus, the copper wire has the greatest gradient, and so it has the least resistance. In order to increase the reliability of my resulting readings, I am going to record the readings while increasing and decreasing the voltage supplied. I will also make use of series and parallel circuits, to verify the law of resistance. To investigate the law of resistance for length. I will use the following type of board for this. The resistance for the 25 cm wire is shown by : The resistance for the 50 cm wire is shown by : This the type of graph I would be expecting to get. As you can see, the line for the 20+30 cm graph falls just a little short of the 50 cm. R = R1+ R2 In addition, to verify the law of resistivity for thickness, we use parallel circuit, which are connected in this manner: Here we will test to see if the resistance of two . 4 mm wires connected in a parallel, is equal to the resistance of a .56 mm wire. This should get me a graph like the one that follows: In order to plot this type of graph, I will have to record my results in a table like this: The resistance for the 0. 4 mm + 0. 4 mm wire is shown by : The resistance for the 0. 56 mm wire is shown by : I did a prior test, or an introductory pre experiment test, to get me used to how to know to work the rheostat, and connect the circuit, and the results I got, are on the next page. Analyzing evidence As you can see from my graphs, which are more or less like the graphs, I had expected to get, in my planning,In order to show that when the length of the wire was changed, the resistance changed proportionately, I created this bar graph. Thus as you can see, when the lengths in crease, the resistance of the wire increases, as there are more collisions between the electron, (which is moving from the negative end to the positive), and between the atom. When length is doubled, resistance doubles. Therefore length is directly proportional to resistance. In addition, I compared the resistance obtained from the tables, when I changed the thickness of the wire, and this is the resulting pie chart. Here too, it is plain to see that when the thickness doubles, the resistance is halved. This is due to, when the thickness increases, there is more space for the electron to pass through, without colliding, and thus resistance decreases. Thus resistance is inversely proportional to resistance. Where as in my series and parallel graphs, the gradient achieved for both the graphs is almost the same, thus I state that the resistance of a longer wire, is the same as two shorter wires connected together in a series circuit. In addition, the resistance of a thicker wire is the same as that of two thinner wires connected in a parallel.

Obstacles To Achieving Sustainable Development

Obstacles To Achieving Sustainable Development There is no definite interpretation of sustainable development. Many scholars agree that the term sustainability is a very general concept and has too many interpretations (Saadatan et al. 2010) the meaning of sustainable development often appears unclear and accordingly underdetermined ambiguous and controversial (Parris and Kates 2003; Robinson 2004; Williams and Millington 2004; Fergus and Rowney 2005, Kates et al, 2005; ) ac cited in (Wuelser et al., 2012) . The term sustainability however originally crops from the ecological field. It was used to refer to an ecosystems potential for subsisting over time with almost no alteration. Later, the term development was introduced. This changed the view from just an environmental one but from that of a society and capital economy (Reboratti, 1999 pp 207-209) as cited by(Jabareen, 2008). Sustainable development on the global scene however, was introduced during the Cocoyoc Declaration on environment and development (Redclift, 1987, p.32) . This new concept was further expounded by the World Commission on Environment and Development (WCED) in 1987. The Commission produced an extensive report, Our Common Future that is commonly referred to as the Brundtland Report after the chair of the committee. The Brundtland reports definition of Sustainable development is the one that seems to be commonly referred to in the international arena. It defined sustainable development (SD) as development that meets the needs of the present without compromising the ability of future generations to meet their own needs. It further breaks down SD into two key concepts; concept of needs, in particular needs of the poor and secondly the concept of limitations that focuses on the technology and social factors and their ability to ensure environmental use to meet present and future needs (WCED, p.43). The report also defines development as a progressive transformation of economy and society (WCED p.43). With regard to the Brundtland reports definition and terminologies, three key aspects come into play, the economy, society and the environment. These three components of sustainable development are interlinked and a balance in the three factions is necessary in order to attain sustainable development. This harmony can only be achieved through equity. Equity as defined by the Oxford dictionary as the quality of being fair or impartial. In relation to the definition of sustainable development fair distribution is necessary to ensure the present and future generation needs are met. Our Common Future focused on the critical issues of equity and environment and raised the important ethical considerations regarding human environment relationships (Langhelle, 1999)****. Under the societal bracket, equity across the generations can be divided into two; intergenerational equity and intragenerational equity. The former acknowledges the future generations. It expects equal distribution of resources between present and future generations. It is the fairness of allocation of resources between current and future generations (Jabareen, 2008). Intragenerational equity on the other hand, refers to the distribution of resources between competing factions of the present day. This type of equity mainly addresses the poor in present society. Sustainable development in this umbrella seeks to ensure poverty is abolished and fairness of distribution of the worlds resources to every individual is met. According to the Brundtland report, the prerequisite for addressing intragenerational equity is a fair distribution of economic and social power. It argues that this can be achieved by participation in decision making and democratic processes for enabling participation and suitable governance needs to be established (WCED, 1987 p.43). However, whilst observing these two types of generational equity, it is clear that the intergenerational equity heavily relies on intragenerational equity. If there is no balance in the present age, exploitations are bound to happen, hence the future generations will be left with little or no capital stock. Therefore, it is essential that the present needs are met by sustainable development practices in order to ensure that the future generations needs are also met. Society cannot live without natural capital. The two factions are interconnected and a balance between the two is essential for attainment of sustainable development. Environmental integrity ensures that the natural stock is well managed so as to meet the needs of future generations. Environmental integrity is the management of natural capital stock so as to ensure future generation access to the same ecosystems. Jabareen (2008) further expounds that the ethical concepts under this umbrella fall into two extreme groups; the domination of nature and the intrinsic rights of nature. The former is represented by the doctrines of light ecology and the latter is governed by doctrines of deep ecology. However, regardless of which doctrine, one key issue is addressed, the sustainability of the natural resources. Natural resource should remain constant over time. Pearce and Turner (1994, p.44) explain that this stock should not decrease in order to avoid endangering the opportunities of the f uture generations ability to generate wealth and well being. This concept commonly known as strong sustainability, seems utopic and frankly highly impossible. The environmental damage has already occurred sustainable development as a strategy is to ensure that what is left and that which is untapped stays intact for future generations to come. The correlation of the three pillars of sustainable development- economic growth, society and the environment seeks to achieve balance under this paradigm. Economic growth under this new discourse is expected to address both environmental and social integrity. Before the concept of sustainable development was formulated, economic growth was perhaps the only driving force of international world. Economic growth in the 20th century has been nothing but destructive. Nevertheless, under the new discourse, it is expected under its objectives not only to achieve economic growth, but also alleviate societal injustices and environmental justice to be adhered to. Poverty alleviation is mandatory under the new framework of economic achievements. As Dodds (2000, pp28-29), argues that poverty and the environmental degradation are interlocking global crisis and that we do not face the choice between environment and development but rather challenge to find ways to integrate the two aspects. Sustainable development as with any new strategy or concept is not short of criticism. Some critics and analysts assert that it is difficult to classify SD as a globalizing force because it falls between fragmentation and integration (Sneddon et. al.2006). Redclift a famous critic of this new discourse argues that it remains unlikely that the developed countries (even developing countries) will put into action these measures. Proponents on the other hand argue, that albeit the process is occurring at a slothful pace, it has been applied extensively around the world and there are some success stories currently taking place both in the Northern and Southern nations. (Sneddon et. al.2006). argues that burgeoning levels of consumption, enhanced levels of ecological degradation, a growing public mistrust of science and vast inequalities in economic opportunities is to blame. Nevertheless, it is clear that sustainable development has yet to be achieved and in actual retrospect, unsustainab le development is winning currently. Perhaps the reason why the process has been ineffective is due to constant change experienced at environmental, social and economic levels in the modern world. However, the process of sustainable development is still important and support in the international community is evident. However, the process is faced by threats from its greatest enemy, a function of neoliberalism, globalization. One of the major obstacles to achieving sustainable development is globalization. Globalization is perhaps the grandest form of obstacle towards SD. This can be owed to the fact that it affects the three pillars of sustainable development; economic growth, social equity and environmental integrity. The precise definition of globalization is not known. Globalization as a term remains elusive (Castells, 1996: Mclauhan, 1962, Van Dijik, 1991; Gigoux and Samson, 2009) .Paehlke (n.d) describes it as simultaneous expansion of international investment and trade, the integration of social, cultural and economic activities and the acceleration of the international community, travel and personal interaction. However, Robinson (2007:125) cited in (Gigoux and Samson ,2009) summarizes the characteristics of globalization as ; a globalized economy involving new systems of production, finance and consumption and world economic integration. New transnational or global cultural patterns, practices an d flows, and the idea of global cultures ,global political process, the rise of new transnational institutions and concomitantly, the spread of global governance and the authority structures of diverse sorts ,unprecedented multidirectional movements of peoples around the world involving new patterns of transnational migration identities and communities and finally new social hierarchies forms of inequalities and relations of domination around the world. From these characteristics globalization is depicted as an international layout that involves integration of systems. Globalization seems unstoppable and is now commonly referred commonly as the new world order. This new paradigm as previously mentioned affects economic social and environmental factors of sustainable development. Proponents of the globalization paradigm see it as a new discourse to achieving social, economic and environmental equity. Dasgupta (2007) asserts that globalization emphasizes the potential of capital accumulation and technological improvements to compensate for environmental degradation. The Brundtland report actually encouraged the internationalization of the three pillars of development. This is probably why globalization has still been accepted as a possible strategy to achieving sustainable development. Contradicting this theory is the current situation occurring globally, the spread of globalization has been unstoppable. It has left in its wake more demerits than merits that have adversely affected sustainable development. Globalization can be said to be biased towards achieving economic growth. The Brundtland report stressed the need for equity in order to achieve sustainable development. The three pillars of sustainable development are highly interlinked. If one is to be encouraged more than the other, imbalance in the system is likely to occur. As Robinson described one of the characteristics of globalization as a new hierarchal form of inequality, it is in this light that we attribute the challenges of sustainable development under the globalization bracket. Globalization has its main objective as economic growth. In an ideal sustainable world, achievement of economic growth should go hand in hand with societal equity and environmental integrity. However, the situation currently being experienced around the globe is one where economic growth has taken precedence. The result is a society that is experiencing the worst forms of inequality. Globalization has opened the markets making it a free global market. Liberation of trade has led to an increase in employment opportunities in most industrialized countries. This has led to a wave of labour migration to occur. Most of these migrant workers come from developing countries. Throughout history, migration has been a courageous expression of the individuals will to overcome adversity and to live a better life (Zollinger, 2007). However, globalization has led to the highest number of labour migrants in history. According to the International Labour Office (ILO,2007) an estimated 191 million wor kers were migrants. In addition, 81 million together with their families accounted for 90% of the international migrants. Globalization has led to a decrease in the regulation of the labour market, growth in the informal sector and a new form of exploitation (Financial Express 2006). This has led to the re introduction of the term, precarious work to be used especially in the neoliberal regime (Munck, 2010). Discrimination against women has also been observed during the process. Female labourers are exploited in terms of work, pay hours and contracts. The United Nations Development Fund for Women (UNIFEM) states that demand for female migrants results from a number of global forces in which gender roles and sex discrimination are intertwined with globalization (Financial Express,2006). The vast number of labour migrations taking place led to the development of international legal frameworks such asà ¢Ã¢â€š ¬Ã‚ ¦.. that cater to the . surprisingly, labour movement are also supportin g the rights of migrant workers. Munck (2010) attributes this to the fact that this has provided the trade unions with a new platform for revitalization after the long neoliberal onslaught. Another negative impact due to globalization that stands out greatly is inequality in income. This has occurred in two forms; international inequality and intranational inequality. The former refers to the difference income levels of citizens of different states. The latter refers to the disparities between individuals of the same state. International income inequality is mainly due to lower economic growth and faster population growth in developing countries than OECD countries (Wade, 2001) as cited in (Borghesi and Vercelli, 2006). Data released by the World bank in 2007 showed that people living on less than a dollar decreased from 1.25billion to 1 billion (World Bank ,2007). However in regions such as the sub-Saharan Africa, the poor increased by 60 million (Zollinger, 2007). The UNDP (2007) stresses this aspect further by stating, the Champaign effect if the world was one country, 201% of the world population would have more than three quarters of worldwide income, while the poo rest 40% would have 5%. An American citizen in 1990 was thirty eight times richer than an inhabitant in Tanzania. This has increased by sixty one times today. (UNDP, 2006). The inequalities between countries according to Lindhert and Williamson (2001) in Borghesi and Vercelli (2006) argue that, those countries that participated in the globalization discourse experienced growth and at the same time opened up their borders to inequality through liberation of markets and following autarkic policies. They further assert that countries excluded or isolated from this process lag behind while those who participate in it join the what they refer to as convergence club. Their thoughts perhaps reflect what Brundtland Commission had predicted asymmetry in international economic relations compounds imbalance as developing nations are generally influenced -by I but unable to influence international conditions (WCED,1987, p.67). Intranational inequality has also increased over the years especial ly in developed countries such as Great Britain and the USA. The number of working poor is increasing at an alarming rate in the industrialized countries. The working class seems to be short changed by the globalization paradigm. Take the case of an American manager, his/her income has increased in the past 20 years from being fourty times higher as the average income to one hundred and ten times. This can be attributed to the different access to globalization between these two factions. Therefore, it can be said that globalization albeit promoting one pillar of sustainable development, i.e. economic growth has led to serious disparities in the social world with high levels of inequality and increase in poverty especially in the developing countries. Sustainable development requires the prudent use of natural resources in order to ensure that future generations enjoy the same access to nature as the present generation. The intrinsic relation between the environment and economic growth together with social factors has led to disastrous changes in the environment. of the three pillars of sustainable development, this is perhaps the worst hit in present day. The consequences of environmental degradation has led to social and political discourse that is least to say wanting. A major function on of globalization is industrialization. The internalization of industrialization to the greatest threat on earth currently, global warming. Global is as a result of extensive industrialization. Stiglitz (2007) asserts that there is no issue as global as global warming; everyone shares the same atmosphere. Emissions from industrialized countries such as the USA and China cross boarders and eventually affect the poorest of the countries in the wo rld. Stiglitz expresses his worry using the case of Bangladesh and the Maldives. Bangladesh is a rice growing country. Due to its location, it is vulnerable to sea levels. Global warming will eventually affect sea levels. The country is likely to be submerged. Stiglitz predicts this to be one third of the country. Being a rice growing nation, their source of livelihoods will simply be destroyed and thus and to the total challenge of global poverty. Maldives on the other hand according to predictions its predicament due to global warming is going to occur very soon. This tropical paradise might be completely submerged in the next fifty years. Natural resources are being exploited at an alarming rate during this period of intense globalization. The destruction of natural resources can only lead to dire consequences on the environment and society as a whole. Natural resources are essential for the lifeline of the planet. Forests are especially important. They are a natural sink for carbon. During this period of increased green house gas emissions, their carbon sequestration is needed to absorb the excess carbon dioxide in the atmosphere. However, the demand for land for development has seen industrialized nations transfer their projects to tropical rain forests which are mostly located in developing countries. Take the example of the Amazonian forest. This is the largest rain forest in the world. However, its distraction is occurring at an alarming rate to give way for development of dams, settlers and loggers. Research stipulates that the Amazonian forests vanishing at a rate of 200,000 square miles a year. On the other si de of the globe, in Africa, Cameroons tropical forest is at risk of multi cooperation exploitation. An example is the Herackles Farm company. It has to date destroyed 72 000 hectares of land. This is for the palm oil project they intend to set up in the region. Palm oil is used to produce biodiesel, a cleaner source of energy to fossil fuel. The destruction of this forest has not only destroyed the landscape of the forest but has also destroyed the migratory paths of the wildlife animals in the tropical forest. Destruction of forests not only affects carbon sequestration, it also affects climatic conditions. Take the case of Kenya, the past ten years has seen the country destroy its major water tower, the Mau forest. This forest has been destroyed mostly to give way to the colonial pressure of land and the government decided to settle people in this forest. What followed is extensive logging in the forest. Microclimatic conditions started occurring following this. The country experi enced the worst drought spell in the year 2009. Agriculture was highly affected and hunger followed. The hydroelectric industry and the tea industry were also affected. This being key revenue sources for the nation (Morgan, 2009). Still on the case of forest depletion, biodiversity loss must be addressed. Biodiversity is one of them major concerns the Brundtland commission had in Our Common Future. Brail boasts around 55 000 species of flora amounting to some 22% of the worlds total. The Convention on Biodiversity (CBD, 2010) reported that forests account for more than two thirds on net primary production on land and the conversion of solar energy into plant matter. Therefore, a global check to ensure sustainable use of natural resources should be addressed and fast. The destruction of natural resources has also led to societal pressures. There is an intrinsic connection between man and nature. This intrinsic connection with nature is slowly being destroyed by globalization. The indigenous peoples for example have been shortchanged by globalization. The indigenous peoples of the world live in the most biodiverse areas of the world. This is probably the reason why they have become prime targets of global corporations who have already depleted their natural resources. GAoing back to the Amazon, one will find the Awa tribe. This tribe are hunters and gathers and rely on the rainforest for their source of livelihood. Encroachment of the forest by loggers and new settlers threat their lifestyle. Survival International (2012,a) in one of their films; The Worlds Most Threatened Tribe, shows the plight of these people. One tribesman is captures asking why are they doing this to us? If they destroy the forest they destroy us. Extractive industries have al so led to loss of biodiversity and added to the plight of the indigenous peoples. According to the UNHCR (2011), extractive industries generated effects that often infringe upon indigenous peoples rights. The Palawan of the Phillipinnes for example are a fighting the nickel mining industry. Mining causes the worst environmental and societal footprints. Mining causes; destruction of landscapes, destruction of agricultural land, sedimentation and erosion soil and water contamination. In a film by the Survival International (2012,b), Palawan Voices from the Last Frontier depicts clearly the plight of these people. A mother is seen worrying about the future generations and how they will manage to experience the forest due to the mining industry. Contamination of their waters has led to diseases that these people who are rarely in contact with others have contracted. With no access to healthcare, they are losing lives. However. Indigenous peoples have managed to fight the tentacles of gl obalization. Armed with the United Nations Declaration on the Rights of the Indigenous Peoples, they are fighting this global order. Economic growth leads to an increase in Industrial activities. This leads to an increase in per capita. This eventually leads to an increase in population that has proved to be a crucial factor in environmental degradation. (Borghesi and Vercelli, 2006). The Brundtland report expressed its concerns on the rate of population growth especially in Africa. For example population pressure in Kenya has led to the destruction of conservation of wildlife. Land use favouring agricultural and rural development has led to reduction of wildlife conservation areas leading to extinction of some species. (Okech, n.d).There is a conflict between the wildlife and humans who have encroached their conservancies and reserves. Human encroachment was estimated to be 72% and loss of conservation due to degradation of wildlife migration corridors was said to be 70% (Okech, n.d). The killings of wildlife by the population due to destruction of agricultural crops from animals such as the elephants has led to a conflict in government. The Government is trapped on whether to support the people or support wildlife interests. More often than not it has resulted in favouring the latter, reason? Tourism in Kenya is one of the largest revenue earners of the country. Still on the issue of wildlife conservation, the opening of borders has enabled an increase in poaching in Kenya. About a hundred elephants are killed in a year in Kenya (BBC, 2013). The free markets have enabled an international market for ivory especially in Asia. Poachers have increased in the country and this is one of the major contentious issues affecting the country currently under globalization. Another major paradigm brought about by the new era of globalization is security. After the cold war, the world was still in a state of security threats. Globalization has brought about migration of people, spread of knowledge, advanced technologies and extreme climate change all of which bring about strong security implications. The more traditional type of security threat brought about by political and military actions has become even more stronger with the advancement of technology in the globalized era. In addition, better transport and communication systems have made the transfer of weapons across borders easier and faster. Advanced technologies have also led to development of weapons of mass destruction (WMD) to spread across the globe. Not only are the super powers such as the US manage to develop these weapons, less developed countries are equipping themselves with these weapons. (Davis, n.d) suggests that strategies need to be developed in order to ensure this security threat is kept intact. He suggests that non proliferation tools such as domestic and international mechanisms for storage and transfer, multilateral export controls, arms control verification and enforcement measures would need to be evaluated. (Davis, n.d). Apart from the traditional form of security threat, climate change has brought about a new type of threat in the new world order. Climate change can lead to transnational threats that occur due to migration, and extensive competition for resources due to environmental stress. This burden may lead to threat of violence especially in vulnerable states. (Dabelko,2008). Take the case of the Ilemi triangle. This is a region that supports a fragile ecosystem charecterised by the only surviving riparian forest. The Ilemi triangle is shared by several countries, Sudan, Kenya and Ethiopia. The pressures of the Gibe III dam and the existing climatic changes may lead for competition of resources such as water grazing land and political conflict involving at least five ethnic tribes. In addition these tribes are equipped with weapons such as guns due to their pastoralists lifestyles. The Brundtland report had already addressed this issue in its introductory chapter of Our Common Future. It asked states to include environmental stress as a possible threat to national sovereignty together with the traditional political and military threats .The UNDP also suggested that environmental security was one area that should constitute a new global security paradigm. (Dabelko, 2008). Prominent reports by the EU, USA and the UK have also addressed this issue in their polices and identified strong linkages between security and the environment for the first time in 2007, the UN security council with a push from the UK devoted a session that addressed the environment as a security issue. Ban Ki Mon also linked the efforts of the UN to battle climate change with its mission to address underlying causes of conflict in Darfur Sudan. (Dabelko, 2008). Another strong body that has supported environmental security is the Norwegian Nobel Committee that called climate change both a fundamental threat to human wellbeing and a contributing factor to more traditional conflict. This was an echo of th e WCED statement in 1987. All the above described factors of the globalization paradigm could be avoided or reduced in order to achieve sustainable development through the global political network and global governance. However, the implementation of most of these international polices have failed and thus dire consequences on sustainable development. Global governance is described as a political process that is meant to address all the problems that are beyond the capacities of a single state (Zollinger, 2007). However, governance starts at national levels. Most states especially those in the South fail to address the human and financial issues to the international arena. The political leadership especially in the developing nations seems to have surrendered to the powers of liberation. Political motivation towards addressing environmental issues is lacking. At the international front, the Rio summit seems to have failed the sustainable development paradigm.. Rio had the hopes of placing the environmental crisis on the international agenda. The environment since the Rio Summit in 1992 has been degraded immensely. Green house gases are at an all time high. Its subsequent convention the Kyoto protocol has also failed to show its strength countries like the USA have withdrawn from the KP regime. The irony is, the USA is the leading producer of GHG emissions. Khor (2001) argues that Rio failed to fulfill its promises because testing of sustainable development did not occur during implementation. Instead, SD came under competition of globalization. Globalization was given a further boost by the Marrakesh accord of 1994 that established the World Trade Organization (WTO) the strength of the WTO was its system which was based on retaliation and sanctions. As the WTO grew, globalization spread and thus undermined the sustainable development para digm (Khor, 2001). In conclusion, the administration of powers should go back to the more neutral organizations like the UN. The globalization proponents the WTO and the Bretton Woods Institutions power in the global world should be neutralized. They are both proponents of liberalism and protectionism (Khor, 2007). Better presentation of the Southern nations at the international scene should occur. This will ensure a possible balance between globalization and Sustainable development. As for now sustainable development paradigm remains to be a utopic dream.